Il Codice Genetico nella Traduzione

Il codice genetico rappresenta il sistema con cui viene tradotta l’informazione genetica per la sintesi di proteine nelle cellule. Di fatto mette in relazione la sequenza di basi azotate del DNA di un gene e la sequenza di amminoacidi di una proteina.

Dopo aver capito la stretta relazione che vi è tra DNA e Proteine, cercheremo ora di capire come l’informazione genetica possa essere “convertita”  in sequenza amminoacidica. I Geni (ovvero specifiche regioni di DNA) vengono trascritti in mRNA, una molecola “ponte” che trasporta l’informazione genetica sino al luogo in cui essa deve essere decifrata; ad esempio, negli Eucarioti, dal Nucleo al Reticolo Endoplasmatico Rugoso, nel Citoplasma.

DNA ed mRNA (Acidi Nucleici) sono molecole simili tra loro, entrambe sono costituite da una sequenza di 4 nucleotidi e, durante la trascrizione, l’esatta sequenza nucleotidica che compone un gene è “copiata” (“riprodotta“)  sull’mRNA. Proteine ed Acidi Nucleici hanno invece un “diverso alfabeto“, le prime sono infatti composte da amminoacidi, molecole molto diverse rispetto ai nucleotidi. La sequenza nucleotidica presente sull’mRNA (e quindi in partenza sul DNA) deve dunque essere, convertita in una sequenza di amminoacidi.

Questo processo prende il nome di Traduzione (o Sintesi Proteica) ed avviene nel Citoplasma, grazie ad organelli chiamati Ribosomi.

Sintesi-proteica

Il primo problema che si pone è come convertire una sequenza composta da 4 nucleotidi (alfabeto a “4 lettere“), in una sequenza proteica composta da 20 amminoacidi (alfabeto a “20 lettere“).

Ovviamente se si associasse ad ogni nucleotide un solo amminoacido, potremmo avere proteine composte solo con quattro tipi di amminoacidi (e non 20).

Se si considerassero due nucleotidi alla volta potremmo ottenere 16 combinazioni diverse (42):

  • AA-AC-AG-AU
  • CA-CC-CG-CU
  • GA-GC-GG-GU
  • UA-UC-UG-UU

Anche in questo secondo caso non sarebbero sufficienti.

Per coprire tutti i 20 diversi amminoacidi, l’mRNA viene letto (tradotto) 3 nucleotidi alla volta. Infatti, avendo a disposizione 4 nucleotidi diversi con cui comporre una sequenza lunga 3 nucleotidi,  si possono ottenere 64 combinazioni (43) diverse.

Queste 64 possibili combinazioni (Triplette) sono chiamate Codoni.

Il Codice Genetico è quindi formato da 64 Codoni

Il Codone con sequenza AUG (Start Codon) è il Codone che codifica per l’amminoacido Metionina, ma è anche quello che determina l’inizio della Sintesi Proteica.

3 Codoni (UAA-UAG-UGA) non sono associati ad amminoacidi, ma determinano la terminazione della Sintesi Proteica, sono perciò chiamati “Stop Codon

I restanti 59 Codoni sono associati ai restanti 19 amminoacidi; per questa ragione si dice che il Codice Genetico è degenerato, ovvero 1 tipo di amminoacido può essere associato (codificato) a più Codoni, ma 1 codone è sempre associato ad un unico e solo amminoacido.

Quindi, avendo una sequenza di DNA, potremmo risalire all’esatta sequenza della proteina da lei codificata, ma avendo una sequenza proteica non potremo risalire con esattezza alla sequenza nucleotidica corrispondente.

Codice-genetico-

Il Codice genetico è praticamente universale, cioè valido in tutti gli organismi, dal Batterio all’Uomo. Solo in rari casi, alcuni organismi possono utilizzare un codice leggermente diverso, ad esempio alcuni lieviti utilizzano il Codone CUG per codificare Serina, invece di Leucina.

Tuttavia organismi diversi possono avere una certa preferenza nell’usare un Codone piuttosto che un altro; ad esempio qualora si dovesse inserire una Lisina in una proteina un organismo potrebbe usare prevalentemente la Tripletta AAA, mentre un altro quella AAG.

Ora supponiamo di avere una corta sequenza di DNA (chiamiamola Gene “prova“) e proviamo a determinare quale sarà la sequenza proteica corrispondente.

(si ricordi che nell’mRNA l’Uracile corrisponde alla Timina presente nel DNA)

Gene “prova :  AGGCATGTTTGTGACTTATCCCCTGGATTATCAGTGGATTCAACACTGACGGCCAA

mRNA “prova AGGCAUGUUUGUGACUUAUCCCCUGGAUUAUCAGUGGAUUCAACACUGACGGCCAA

La sequenza prima di AUG (Codone di inizio) e quella dopo UGA (Codone di Stop) non vengono tradotte in sequenze aminoacidiche.

Considerando solo la sequenza compresa tra AUG ed UGA, suddividiamo con un trattino le varie triplette, per meglio distinguerle e poi cerchiamo sulla tabella del Codice Genetico gli amminoacidi corrispondenti.

AGGC /inizio traduzione AUGUUU-GUG-ACU-UAU-CCC-CUG-GAU-UAU-CAG-UGG-AUU-CAA-CACUGA / fine traduzione CGGCCAA

Proteina “prova : Met-Phe-Val-Thr-Tyr-Pro-Leu-Asp-Tyr-Gln-Trp-Ile-Gln-His

La sequenza degli amminoacidi in una proteina determina la sua funzione biologica e la capacità o meno di catalizzare specifiche reazioni Biochimiche. Questa sequenza amminoacidica è a sua volta una “decifrazione” dell’informazione genetica contenuta nel DNA.

Articoli correlati